ID: 1014208910_1014208917 |
View in Genome Browser |
Spacer: 19 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1014208910 | 1014208917 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:118687752-118687774 | 6:118687794-118687816 |
| Sequence | CCGTCCACCACTGCTGTTTGCCG | GACTTCCATCCCTCCAGATCTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 29, 1: 69, 2: 102, 3: 85, 4: 220} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||