|
Left Crispr |
Right Crispr |
| Crispr ID |
1014414944 |
1014414948 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:121172421-121172443
|
6:121172449-121172471
|
| Sequence |
CCATTAGGGTGTCTCCTGGTATT |
GCCCTGTGATTAAGATCAATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 7, 2: 80, 3: 147, 4: 315} |
{0: 16, 1: 226, 2: 236, 3: 134, 4: 131} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|