ID: 1014414945_1014414948 |
View in Genome Browser |
Spacer: -9 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1014414945 | 1014414948 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 6:121172435-121172457 | 6:121172449-121172471 |
Sequence | CCTGGTATTACCATGCCCTGTGA | GCCCTGTGATTAAGATCAATGGG |
Strand | - | + |
Off-target summary | No data | {0: 16, 1: 226, 2: 236, 3: 134, 4: 131} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |