ID: 1014414945_1014414948

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1014414945 1014414948
Species Human (GRCh38) Human (GRCh38)
Location 6:121172435-121172457 6:121172449-121172471
Sequence CCTGGTATTACCATGCCCTGTGA GCCCTGTGATTAAGATCAATGGG
Strand - +
Off-target summary No data {0: 16, 1: 226, 2: 236, 3: 134, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!