ID: 1014534196_1014534200

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1014534196 1014534200
Species Human (GRCh38) Human (GRCh38)
Location 6:122596612-122596634 6:122596658-122596680
Sequence CCAGTAATAGGCCAAGAGCTCTC AGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 21, 2: 197, 3: 206, 4: 211} {0: 185, 1: 187, 2: 104, 3: 111, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!