ID: 1014992256_1014992261 |
View in Genome Browser |
Spacer: 9 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1014992256 | 1014992261 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:128095460-128095482 | 6:128095492-128095514 |
| Sequence | CCATGGTTTTTAGTTTCTGTTTC | GTGGAAAAGAGGGATGAGGAAGG |
| Strand | - | + |
| Off-target summary | {0: 6, 1: 59, 2: 76, 3: 139, 4: 911} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||