|
Left Crispr |
Right Crispr |
| Crispr ID |
1015002451 |
1015002453 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:128234950-128234972
|
6:128234991-128235013
|
| Sequence |
CCATAGGGTGACTATAGTTAACA |
AATAACTTAAAAAGTGGAATTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 20, 2: 57, 3: 94, 4: 204} |
{0: 1, 1: 16, 2: 178, 3: 610, 4: 1832} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|