ID: 1015027991_1015027996

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1015027991 1015027996
Species Human (GRCh38) Human (GRCh38)
Location 6:128560331-128560353 6:128560374-128560396
Sequence CCGTAGAACCTTGCATCTTTCTT TTTCAGTGGCTTTTAGAAAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 46, 4: 500}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!