ID: 1015095448_1015095452 |
View in Genome Browser |
Spacer: 12 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1015095448 | 1015095452 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:129409590-129409612 | 6:129409625-129409647 |
| Sequence | CCCAGTAACAGGCCAAGAGTTGT | GAGTAGTGATCTGCAGAAGATGG |
| Strand | - | + |
| Off-target summary | {0: 17, 1: 184, 2: 186, 3: 148, 4: 230} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||