|
Left Crispr |
Right Crispr |
| Crispr ID |
1015095449 |
1015095454 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:129409591-129409613
|
6:129409630-129409652
|
| Sequence |
CCAGTAACAGGCCAAGAGTTGTC |
GTGATCTGCAGAAGATGGCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 17, 1: 171, 2: 183, 3: 131, 4: 176} |
{0: 1, 1: 187, 2: 167, 3: 145, 4: 286} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|