ID: 1015144263_1015144271

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1015144263 1015144271
Species Human (GRCh38) Human (GRCh38)
Location 6:129967994-129968016 6:129968042-129968064
Sequence CCTGGCAGTTTTCTCAGAGGAGG CAAGGTGTACCTTGGGAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!