ID: 1015443282_1015443289 |
View in Genome Browser |
Spacer: 22 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1015443282 | 1015443289 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:133272548-133272570 | 6:133272593-133272615 |
| Sequence | CCAAAGCCCAGTAATGGGCCAAG | AGTTATCTGTAGAAGATGGTTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 17, 2: 220, 3: 200, 4: 291} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||