|
Left Crispr |
Right Crispr |
| Crispr ID |
1015443286 |
1015443289 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:133272566-133272588
|
6:133272593-133272615
|
| Sequence |
CCAAGAGCTGTCTCTCAAAAGGA |
AGTTATCTGTAGAAGATGGTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 181, 1: 197, 2: 163, 3: 130, 4: 293} |
{0: 1, 1: 17, 2: 220, 3: 200, 4: 291} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|