ID: 1015565657_1015565661

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1015565657 1015565661
Species Human (GRCh38) Human (GRCh38)
Location 6:134567824-134567846 6:134567846-134567868
Sequence CCCTCTCTGAGACTCTGCCCTGC CTCTTAAACTGCCTCTGTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 522} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!