ID: 1015621841_1015621850

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1015621841 1015621850
Species Human (GRCh38) Human (GRCh38)
Location 6:135140014-135140036 6:135140051-135140073
Sequence CCTGTAATCCCAGCTACTCAGGA GATCACTTAAACCCGGCAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 13, 2: 660, 3: 13845, 4: 61813}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!