ID: 1016019406_1016019411

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1016019406 1016019411
Species Human (GRCh38) Human (GRCh38)
Location 6:139220010-139220032 6:139220038-139220060
Sequence CCCCTCAAATTCATATGTTGAAA ACTCTCAAACTGATGGTATTAGG
Strand - +
Off-target summary {0: 32, 1: 299, 2: 1198, 3: 2758, 4: 5321} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!