ID: 1016019408_1016019411

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1016019408 1016019411
Species Human (GRCh38) Human (GRCh38)
Location 6:139220012-139220034 6:139220038-139220060
Sequence CCTCAAATTCATATGTTGAAATC ACTCTCAAACTGATGGTATTAGG
Strand - +
Off-target summary {0: 109, 1: 668, 2: 1885, 3: 3309, 4: 4389} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!