ID: 1016153858_1016153868

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1016153858 1016153868
Species Human (GRCh38) Human (GRCh38)
Location 6:140780105-140780127 6:140780123-140780145
Sequence CCATTCCCCATCCCCTGTCAGCC CAGCCACAGTATGGTGCAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 18, 3: 209, 4: 1354} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!