ID: 1016153861_1016153871

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1016153861 1016153871
Species Human (GRCh38) Human (GRCh38)
Location 6:140780112-140780134 6:140780143-140780165
Sequence CCATCCCCTGTCAGCCACAGTAT GGGCGCGTTTCTGTGCACTAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 240} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!