ID: 1016245130_1016245139

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1016245130 1016245139
Species Human (GRCh38) Human (GRCh38)
Location 6:141971281-141971303 6:141971331-141971353
Sequence CCCTCAAAGGGAAGCCCATCAGA CTACAAGGCAGAAGAGAGTGGGG
Strand - +
Off-target summary No data {0: 30, 1: 5984, 2: 3315, 3: 1866, 4: 1916}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!