ID: 1016444920_1016444928

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1016444920 1016444928
Species Human (GRCh38) Human (GRCh38)
Location 6:144121378-144121400 6:144121424-144121446
Sequence CCTGCTGGATCCGGAGGGGTGGA TGGCAAACAGCAGTGGTGGATGG
Strand - +
Off-target summary No data {0: 41, 1: 78, 2: 97, 3: 99, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!