ID: 1016451969_1016451974

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1016451969 1016451974
Species Human (GRCh38) Human (GRCh38)
Location 6:144192602-144192624 6:144192619-144192641
Sequence CCATCCCCTGCTCCTTCTGTCTA TGTCTATCTTAACTTGCAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 81, 4: 839} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!