|
Left Crispr |
Right Crispr |
| Crispr ID |
1016576255 |
1016576261 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:145572570-145572592
|
6:145572615-145572637
|
| Sequence |
CCAAAGCCCAGTAACAGACCAAG |
AGTTATCTGCAGAAAACGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 14, 1: 178, 2: 170, 3: 117, 4: 237} |
{0: 1, 1: 17, 2: 203, 3: 197, 4: 203} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|