ID: 1016576259_1016576261

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1016576259 1016576261
Species Human (GRCh38) Human (GRCh38)
Location 6:145572588-145572610 6:145572615-145572637
Sequence CCAAGAGCTGTCTCTCAAAAGGA AGTTATCTGCAGAAAACGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 17, 2: 203, 3: 197, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!