ID: 1017000522_1017000527

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1017000522 1017000527
Species Human (GRCh38) Human (GRCh38)
Location 6:149993967-149993989 6:149993985-149994007
Sequence CCCCCATTACTCATTTCTGTTGA GTTGAAGATTAGATGGCTTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 14, 2: 139, 3: 620, 4: 1406}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!