ID: 1017004901_1017004904

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1017004901 1017004904
Species Human (GRCh38) Human (GRCh38)
Location 6:150022636-150022658 6:150022653-150022675
Sequence CCCTGTGGATGCTGGTGCTGGTT CTGGTTGAACAGAGTGAGGATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 6, 3: 20, 4: 244} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!