|
Left Crispr |
Right Crispr |
| Crispr ID |
1017260092 |
1017260106 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:152375979-152376001
|
6:152376021-152376043
|
| Sequence |
CCCCAACCTTTTTGGCACCAGGG |
ATTTTTCCACAGATGGGGTGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 949, 1: 1567, 2: 1323, 3: 855, 4: 618} |
{0: 8, 1: 32, 2: 102, 3: 250, 4: 712} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|