ID: 1017260094_1017260106

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1017260094 1017260106
Species Human (GRCh38) Human (GRCh38)
Location 6:152375980-152376002 6:152376021-152376043
Sequence CCCAACCTTTTTGGCACCAGGGA ATTTTTCCACAGATGGGGTGGGG
Strand - +
Off-target summary No data {0: 8, 1: 32, 2: 102, 3: 250, 4: 712}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!