ID: 1017260100_1017260106 |
View in Genome Browser |
Spacer: 2 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1017260100 | 1017260106 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 6:152375996-152376018 | 6:152376021-152376043 |
Sequence | CCAGGGAGTGGTTTCAGGGAAGA | ATTTTTCCACAGATGGGGTGGGG |
Strand | - | + |
Off-target summary | No data | {0: 8, 1: 32, 2: 102, 3: 250, 4: 712} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |