ID: 1017524746_1017524752

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1017524746 1017524752
Species Human (GRCh38) Human (GRCh38)
Location 6:155232669-155232691 6:155232688-155232710
Sequence CCAGGCCTATGGCTCAACACAGA CAGAGTGGGTCGGCATGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113} {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!