ID: 1017662383_1017662391

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1017662383 1017662391
Species Human (GRCh38) Human (GRCh38)
Location 6:156687314-156687336 6:156687328-156687350
Sequence CCGCCCGGCGCGGGGCGCGCGGG GCGCGCGGGGTCCGGGTCCCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 49, 4: 349} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!