ID: 1017709594_1017709600

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1017709594 1017709600
Species Human (GRCh38) Human (GRCh38)
Location 6:157155402-157155424 6:157155433-157155455
Sequence CCTTTGCTGTCCCTGAGAGAGCC ACTAACTGAGCATCAGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 213} {0: 1, 1: 0, 2: 0, 3: 16, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!