ID: 1017899980_1017899989 |
View in Genome Browser |
Spacer: 26 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1017899980 | 1017899989 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:158711452-158711474 | 6:158711501-158711523 |
| Sequence | CCATCTGCAAACTGGAGACCCTG | AGTCCCAAGGTGTCGGCGCCAGG |
| Strand | - | + |
| Off-target summary | {0: 3, 1: 30, 2: 187, 3: 387, 4: 778} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||