ID: 1018023725_1018023734

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1018023725 1018023734
Species Human (GRCh38) Human (GRCh38)
Location 6:159788525-159788547 6:159788561-159788583
Sequence CCCTAAACAAAGCGAGCCTATTT TGCGGGGTGGAATCTGATGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 78} {0: 1, 1: 1, 2: 3, 3: 9, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!