ID: 1018122929_1018122930

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1018122929 1018122930
Species Human (GRCh38) Human (GRCh38)
Location 6:160655224-160655246 6:160655246-160655268
Sequence CCAATAGCTGTCTCTCAAAAGGA AGAGTAGTTATCTGCAGAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 5, 3: 16, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!