ID: 1018516716_1018516722

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1018516716 1018516722
Species Human (GRCh38) Human (GRCh38)
Location 6:164588558-164588580 6:164588580-164588602
Sequence CCACCCTCACACAGGCGAGTTAA AGGCCAAGGCAGGACTTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 58} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!