ID: 1018527489_1018527495

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1018527489 1018527495
Species Human (GRCh38) Human (GRCh38)
Location 6:164729074-164729096 6:164729096-164729118
Sequence CCCCACACAGAGCCTTCACTGAG GGCACTGCCTAGTGGAGCTGTGG
Strand - +
Off-target summary No data {0: 65, 1: 140, 2: 181, 3: 209, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!