ID: 1018551342_1018551362

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1018551342 1018551362
Species Human (GRCh38) Human (GRCh38)
Location 6:165001864-165001886 6:165001915-165001937
Sequence CCCTGGTACTAAGCCCCTCACTG TGCTGGCCCGCGAGCGCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 21, 2: 719, 3: 800, 4: 578} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!