ID: 1018645943_1018645948

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1018645943 1018645948
Species Human (GRCh38) Human (GRCh38)
Location 6:165948647-165948669 6:165948690-165948712
Sequence CCATCGAGGTGAGAAACAAGGTG GTGGGTGGACAGTCTAAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 135} {0: 1, 1: 0, 2: 1, 3: 23, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!