ID: 1018757499_1018757514

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1018757499 1018757514
Species Human (GRCh38) Human (GRCh38)
Location 6:166862766-166862788 6:166862801-166862823
Sequence CCCCAGCCCGCCGCGCCTCCCCG GCCACCTCCCGCCGCAGAACGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 6, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!