ID: 1018821508_1018821513

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1018821508 1018821513
Species Human (GRCh38) Human (GRCh38)
Location 6:167377560-167377582 6:167377590-167377612
Sequence CCGCAGTGCAGAAGCAGGGATCG CTGCGAGCCCCCAGACGCACGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 15, 4: 142} {0: 2, 1: 0, 2: 3, 3: 9, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!