ID: 1018855328_1018855339

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1018855328 1018855339
Species Human (GRCh38) Human (GRCh38)
Location 6:167670433-167670455 6:167670484-167670506
Sequence CCCTGCTCCAGAAGCATGGGTGG AGGTCTCTCCTTCTCCGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 194} {0: 1, 1: 0, 2: 0, 3: 13, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!