ID: 1019011591_1019011596

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1019011591 1019011596
Species Human (GRCh38) Human (GRCh38)
Location 6:168847559-168847581 6:168847572-168847594
Sequence CCAGCTGTTTCTCTTGTCTACTG TTGTCTACTGATGGTGCCGGGGG
Strand - +
Off-target summary {0: 13, 1: 13, 2: 4, 3: 28, 4: 305} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!