ID: 1019270798_1019270802

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1019270798 1019270802
Species Human (GRCh38) Human (GRCh38)
Location 7:147252-147274 7:147277-147299
Sequence CCATGGAAAAAGGACCTAACAAA ATGCCCTTCTAGAAGAGGGAAGG
Strand - +
Off-target summary {0: 39, 1: 40, 2: 27, 3: 29, 4: 254} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!