|
Left Crispr |
Right Crispr |
Crispr ID |
1019301207 |
1019301216 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
7:304384-304406
|
7:304418-304440
|
Sequence |
CCGGCCACCTTCATCCAGGTGTG |
CGTCCTGCACAGGCACCCTGGGG |
Strand |
- |
+ |
Off-target summary |
No data |
No data |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|