ID: 1019335338_1019335348

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1019335338 1019335348
Species Human (GRCh38) Human (GRCh38)
Location 7:480106-480128 7:480144-480166
Sequence CCAACCTCCCTTCCTAGAAAGCG AGCCTTGAAATCGGAGCGTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!