ID: 1019340739_1019340744

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1019340739 1019340744
Species Human (GRCh38) Human (GRCh38)
Location 7:507707-507729 7:507728-507750
Sequence CCTCCAAAATATAACCAGGGAGG GGATGCCAAGGCCCACCGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 123} {0: 1, 1: 0, 2: 2, 3: 4, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!