ID: 1019431365_1019431372

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1019431365 1019431372
Species Human (GRCh38) Human (GRCh38)
Location 7:1001313-1001335 7:1001339-1001361
Sequence CCACTGCCATGTGGGTGAGTGGA CTGTGGGTGTGGAGCCCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 225} {0: 3, 1: 0, 2: 40, 3: 48, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!