ID: 1019502198_1019502210

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1019502198 1019502210
Species Human (GRCh38) Human (GRCh38)
Location 7:1369891-1369913 7:1369942-1369964
Sequence CCCTACTAGGTGGGGCTAGCTGA TGGGATTGCTCCCCCAAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 63} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!