ID: 1019522733_1019522748

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1019522733 1019522748
Species Human (GRCh38) Human (GRCh38)
Location 7:1468012-1468034 7:1468052-1468074
Sequence CCCTCAGCACCCTCCCCATCCTC CACGACCCCAGCCAACGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 166, 4: 1537} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!