ID: 1019553932_1019553943

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1019553932 1019553943
Species Human (GRCh38) Human (GRCh38)
Location 7:1619423-1619445 7:1619465-1619487
Sequence CCAAGTGCGTTGGTAAGAACGCG TGGAACCGTCTGAGCGGCGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!